Loading...Please Wait...

Instead of large read files, we only accept compressed clean read files as the input for sRNADeep. Below are the steps to generate required compressed files:


1. We suggest you to use Fastq-Mcf (http://code.google.com/p/ea-utils/wiki/FastqMcf) to filter your reads. As your reads may contain adapter sequences, you should firstly prepare a file containing the adapter information.

One example should be:


adapters.file

>5' adapter

GUUCAGAGUUCUACAGUCCGACGAUC

>3' adapter

TGGAATTCTCGGGTGCCAAGG


2. Then, you have to define criteria for generating the high-quality reads. Here, we use the minimum trim quality of 20 and the minimum read length of 10. An example command is:

ls *.fastq|while read i; do ./fastq-mcf -f -q 20 -l 10 -o ${i%.fastq}.clean.fq ../adapters.fa $i;done


3. After generating the clean reads, you could compress the raw sequence reads using the following command:

ls *.clean.fq|while read i; do gzip $i;done


4. After successful compression, you are now ready to upload your data to sRNADeep for analysis.


Please don't upload reads file(s) larger than 1G. Thanks.

Single sample 

Upload your single transcriptome data here and we will send you an job ID.
Sample data: 

Two samples 

Upload your multiple transcriptomes data here and we will send you an job ID.
Control Dataset: 

Sample Dataset: 

Group samples 

Upload your multiple transcriptomes data here and we will send you an job ID.
Control Dataset1: 

Control Dataset2: 

Sample Dataset1: 

Sample Dataset2: 

Get Result 

Enter your job ID here to retrieve your results.

Quick start guide for sRNADeep, click here.